9  adding a highlighting effect on a table row

Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Ngày tải lên : 05/03/2014, 23:20
... histological analyses Conventional hematoxylin and eosin stain was performed FEBS Journal 278 (2011) 3119–3129 ª 2011 The Authors Journal compilation ª 2011 FEBS E A Karavia et al in order to evaluate ... Journal compilation ª 2011 FEBS 3125 Apolipoprotein E and diet-induced NAFLD E A Karavia et al possibility is that the effects of apoE on hepatic lipid accumulation are mediated by LDLr-related protein ... (mice containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the maintenance of plasma lipid homeostasis, apoE plays a central...
  • 11
  • 544
  • 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Ngày tải lên : 15/03/2014, 10:20
... our analysis are reported in Table As an aside, we also estimate two OLS panel regressions, a …rst of GDP growth on total loan growth and a second of GDP growth on changes in credit standards At ... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... regressions of GDP on loan growh and changes in credit standards This table reports IV panel regressions of GDP growth on loan growth (Panel A) as well as GDP growth on loan growth and changes...
  • 30
  • 911
  • 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Ngày tải lên : 23/03/2014, 21:20
... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...
  • 5
  • 435
  • 0
Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx

Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx

Ngày tải lên : 29/03/2014, 03:21
... afternoon, three days after the Thursday auction The other pair of tickets was to a regular season baseball game, between the Red ALWAYS LEAVE HOME Sox and the Toronto Blue Jays There was also a consolation ... tables in a large meeting room As a break between the orientation activities, they were invited to purchase a dinner certi®cate at a nearby restaurant The restaurant is a local landmark and is within ... entertain more complex ®nancial explanations (e.g., maintaining some precautionary cash balances, and so forth), it seems implausible that our respondents would accept loans at the high exchange rates...
  • 8
  • 344
  • 0
báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

Ngày tải lên : 19/06/2014, 22:20
... Sayah S, Patte C, Gasque P, Chan P, Ischenko A, Vaudry H, Fontaine M: Characterization of rat C 5a anaphylatoxin receptor (C5aR): cloning of rat C5aR cDNA and study of C5aR expression by rat astrocytes ... showing that the response was specific Thus, the NGF mRNA increase acted via the anaphylatoxins/anaphylatoxin receptors and was not due to contaminants in anaphylatoxin preparations Analysis of ... sense [AGG TGC ATA GCG TAA TGT CC], NGF antisense [CCT TGA CAA AGG TGT GAG TC], GAPDH sense [TGC CAT CAA CGA CCC CTT CA] and GAPDH antisense [TGA CCT TGC CCA CAG CCT TG] The theoretical size was...
  • 10
  • 777
  • 0
báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

Ngày tải lên : 19/06/2014, 22:20
... SM, Holtzman DM: Peripheral anti -A beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, ... http://www.jneuroinflammation.com/content/3/1/17 mice, coronal sections of each mouse hemibrain were analyzed for changes in immunostained A plaque loads Quantitative image analysis of amyloid plaque burden in all ... indicate that there is the potential of exacerbation of cerebral-amyloid angiopathy (CAA) associated microhemmorhages in certain mouse strains following passive immunization with certain anti -A antibodies...
  • 13
  • 410
  • 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Ngày tải lên : 20/06/2014, 01:20
... NS/1 6A( 5U) NS/1 6A( 6U) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA)...
  • 11
  • 427
  • 0
Báo cáo lâm nghiệp:"The extreme drought in the 1920s and its effect on tree growth deduced from tree ring analysis: a case study in North China" ppsx

Báo cáo lâm nghiệp:"The extreme drought in the 1920s and its effect on tree growth deduced from tree ring analysis: a case study in North China" ppsx

Ngày tải lên : 08/08/2014, 01:21
... typical steppe Thus, a tree-ring database covering a broad range of spatial and temporal scales may provide an alternative approach to assess and understand the stand dynamics of the remnant Meyer ... (HHT) in an agro-pastoral ecotone of central Inner Mongolia, and one Korean spruce (Picea koraiensis Nakai) chronology (BYAB) from a forest-steppe ecotone in eastern Inner Mongolia Thus, another ... 10 km is situated along the middle reaches of the Xilin River Perennial and annual grasses are dominant in this region and form a typical steppe landscape A patch (about ha) of natural Meyer spruce...
  • 8
  • 396
  • 0
Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx

Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx

Ngày tải lên : 08/08/2014, 14:22
... semi-arid tropical Africa [8, 9, 17] The Acacia species remain very abundant in savannas and arid regions of Australia, Africa, India and the Americas They generally are dependent on mycorrhizae ... mineral nutrient concentrations [2] This biological effect was demonstrated for other Australian acacia species such as Ectomycorrhization of Acacia holosericea in Senegal A mangium [16] The mean ... camaldulensis plantations whereas one was associated with A mangium, one with Casuarina equisetifolia and two with A holosericea Compatibility tests performed under axenic conditions between A...
  • 6
  • 348
  • 0
Báo cáo khoa học: "Flowering and cone production variability and its effect on parental balance in a Scots pine clonal seed orchard" docx

Báo cáo khoa học: "Flowering and cone production variability and its effect on parental balance in a Scots pine clonal seed orchard" docx

Ngày tải lên : 08/08/2014, 18:21
... of a crown (with male vs female flowers) of a plus tree may increase maleness variation among ramets (within clones) and finally may cause negative environmental correlations On the other hand, ... order to analyze the extent of variation of cone production among clones, a two-way ANOVA model was used (table III) Clones and ramets within clones were assumed to be random, whereas the years were ... probably as a consequence of variation in pollen and seed cone production among clones (tablesI and III) The presence of sexual asymmetry may be considered advantageous for the reduction of probability...
  • 16
  • 352
  • 0
Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx

Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx

Ngày tải lên : 09/08/2014, 10:20
... damage (Fig 1E) Fractionated radiation caused less mucosal damage than the same total dose given as a single fraction This damage-sparing effect by fractionating the radiation was retained also ... histological analysis: radiation alone (n = 4), 5-FU alone (n = 1), oxaliplatin alone (n = 6), radiation + 5-FU (n = 2), radiation + oxaliplatin (n = 3), radiation + 5-FU + oxaliplatin (n = 2) and ... oxaliplatin dose = mg/kg Abbreviations: oxa = oxaliplatin Special thanks to Margaretha Olsson and Christina Boll for all help with breeding and treating the animals and jejunal sample preparation...
  • 7
  • 298
  • 0
Báo cáo y học: "Hepatitis B virus core protein with hot-spot mutations inhibit MxA gene transcription but has no effect on inhibition of virus replication by interferon a" pptx

Báo cáo y học: "Hepatitis B virus core protein with hot-spot mutations inhibit MxA gene transcription but has no effect on inhibition of virus replication by interferon a" pptx

Ngày tải lên : 12/08/2014, 01:22
... (experimental group)] Real-time analysis of MxA mRNA and HBV DNA levels Determination of hepatitis B surface antigen (HBsAg) For real-time analysis of MxA mRNA detection, 500 ng of total RNA were converted ... the antibody (anti-Flag, 1:3000; poly-anti-rabbit b-actin, 1:500) The monoclonal anti-Flag antibody was purchased from the Invitrogen Company and poly-anti-rabbit b-actin antibody was purchased ... group)]/mean (control group) Statistics Results are reported as means ± standard deviation (SD) Differences among groups were tested for significance by one-way analysis of variance (ANOVA) Values of...
  • 6
  • 351
  • 0
Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx

Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx

Ngày tải lên : 12/08/2014, 15:23
... Sanna S, Maschio A, Busonero F, Usala G, Mulas A, Lai S, Dei M, Orrù M, Albai G, Bandinelli S, Schlessinger D, Lakatta E, Scuteri A, Najjar SS, Guralnik J, Naitza S, Crisponi L, Cao A, Abecasis ... simplest conclusion is that the C-allele of rs3733591 has a weaker effect on gout per se in Caucasian and Polynesian populations than in the Asian and Melanesian populations studied thus far However ... Zealand Jade Hollis-Moffatt was supported by a New Zealand National Heart Foundation Research Fellowship Amanda Phipps-Green, Marilyn Merriman and Ruth Topless are thanked for expert technical...
  • 25
  • 266
  • 0
Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot

Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot

Ngày tải lên : 13/08/2014, 16:20
... concentrations of plasma proteins mean that even greater hydrostatic pressure and higher perfusion rates can be applied in narrow capillaries without risking tissue edema, a ceiling on plasma ... concentration So, if the intracellular pH is normal, similar Donnan effects on chloride ions can be expected in all Cl permeable cells The consequence is that similar intra- and extra-cellular ... potassium concentration gradients and this independence of sodium pumping can make it act as an important safety feature against involuntary, or spastic, skeletal muscle contraction Page of Kurbel...
  • 9
  • 310
  • 0
Báo cáo y học: " Blood product ratio in acute traumatic coagulopathy - effect on mortality in a Scandinavian level 1 trauma centre" pptx

Báo cáo y học: " Blood product ratio in acute traumatic coagulopathy - effect on mortality in a Scandinavian level 1 trauma centre" pptx

Ngày tải lên : 13/08/2014, 23:20
... interpretation of data; SRO: has made substantial contributions to analysis and interpretation of data; PIJ has made substantial contributions to conception and design, acquisition of data, analysis and ... study was that a change in transfusion therapy with more aggressive and early administration of plasma and platelets in relation to RBC did not influence survival in the trauma patients investigated, ... data base LOS and 30 day mortality were obtained from the database of the hospital and the Page of Central Office of Civil Registration All data were collected and entered into a study database...
  • 9
  • 200
  • 0
Báo cáo sinh học: " Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy of genomic prediction" potx

Báo cáo sinh học: " Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy of genomic prediction" potx

Ngày tải lên : 14/08/2014, 13:21
... national conventional evaluation for all bulls Forty-four traits from seven trait groups were analysed: milk production (three traits), udder health (one trait), functional longevity (one trait), ... The total additive genetic variance, a , was obtained from a conventional pedigree-based analysis, e.g for milk production traits [6] and for female fertility traits [7], and was partitioned into ... the p markers (1 − w) a We assumed that all markers contribute equal genetic variance The proportion of residual polygenic variance w was assumed to vary across traits The optimal w value was determined...
  • 9
  • 524
  • 0
A suggested analytical solution of oblique crack effect on the beam vibration

A suggested analytical solution of oblique crack effect on the beam vibration

Ngày tải lên : 09/09/2015, 10:17
... Mechanical Properties of Engineering Materials, Control and Stability of Mechanical Application, Damage (Crack and Delamination Analysis) and other mechanical researches E-mail address: muhanedl.alwaeli@uokufa.edu.iq&muhannad_al_waily@yahoo.com ... Mechanics, Graduation Date: 2002 Research Interests, Vibration Analysis, Stress Analysis under Static and Dynamic Loading, Composite Materials, Fatigue and Creep Analysis of Engineering Materials, ... depth and location effect and the results are compared The analytical results of the effect of a crack in a continuous beam are calculated the equivalent stiffness, EI, for a rectangular beam to...
  • 20
  • 218
  • 0
Ground effect on a lift generating body

Ground effect on a lift generating body

Ngày tải lên : 07/10/2015, 10:10
... attack AoA Angle of Attack (used only in figures) AMF Model frontal area ATS Cross sectional area of test section A, B,X General symbols for measured or calculated quantities AR Aspect ratio b ... Ahmed and Sharma 138 F Summary of Experimental Data from Kwang, Ho and Hee 142 G Summary of Experimental Data from Ahmed 145 H Summary of Experimental Data from Ahmed, Takasaki and Kohama149 ... Experimental data from NACA TN 67 117 C Summary of Experimental Data from NASA TN D926 125 D Summary of Experimental Data from Chawla, Edwards and Franke 135 E Summary of Experimental Data from Ahmed...
  • 250
  • 567
  • 0
bài 9. châu Á thế kỉ 18-19

bài 9. châu Á thế kỉ 18-19

Ngày tải lên : 09/06/2013, 01:26
... ĐỒ ẤN ĐỘ THẾ KỶ XVIII-XIX an New Delhi THAR DESERT Ganges River India Kolkata (Calcutta) Hyderabab DECCAN PLATEAU Bangalore 1877:Nữ hoàng vương quốc Anh Vích- to –ra a nữ vương Ấn Độ Giá trị ... Hoạt động chia làm hai phái “Phái cấp tiến” Phái “Ôn hoà” Mehta Tilak Tilak A n giaùo Hoài gaùo Ben-gan * Bài tập củng cố : Bài tập 1:Chọn phương án Đúng –Sai Ý ngh a phong trào đấu tranh giải phóng ... mốc thời gian cột A với kiện cột B để hoàn thiện phong trào đấu tranh nhân dân Ấn Độ chống thực dân A nh kỷ XVIII- đầu XIX Cột A ( Thời gian) Cột B ( kiện ) A. 1857- 1859 Khởi ngh a Bom bay B 1885...
  • 14
  • 572
  • 0
bài 9: Châu á thế kỉ XVIII-XIX

bài 9: Châu á thế kỉ XVIII-XIX

Ngày tải lên : 09/06/2013, 01:27
... ĐỒ ẤN ĐỘ THẾ KỶ XVIII-XIX an New Delhi THAR DESERT Ganges River India Kolkata (Calcutta) Hyderabab DECCAN PLATEAU Bangalore 1877:Nữ hoàng vương quốc Anh Vích- to –ra a nữ vương Ấn Độ Giá trị ... Hoạt động chia làm hai phái “Phái cấp tiến” Phái “Ôn hoà” Mehta Tilak Tilak A n giaùo Hoài gaùo Ben-gan * Bài tập củng cố : Bài tập 1:Chọn phương án Đúng –Sai Ý ngh a phong trào đấu tranh giải phóng ... mốc thời gian cột A với kiện cột B để hoàn thiện phong trào đấu tranh nhân dân Ấn Độ chống thực dân A nh kỷ XVIII- đầu XIX Cột A ( Thời gian) Cột B ( kiện ) A. 1857- 1859 Khởi ngh a Bom bay B 1885...
  • 14
  • 577
  • 0

Xem thêm